Frontiers | Rapid whole genome sequencing methods for RNA viruses
pBAT series of vectors – Hyvönen Group @ Biochemistry, Cambridge
Primers for MALDI-TOF MS MLST of S. pneumoniae Primer Sequence (5-3) a... | Download Table
Untitled
cDNA library construction from a small amount of RNA: adaptor-ligation approach for two-round cRNA amplification using T7 and SP6 RNA polymerases | BioTechniques
Subcloning | An Introduction to Subcloning Methods
Addgene: SP6-VEE-IRES-Puro
![Sequences of T7 and SP6 promotor on pGEM-T Easy vector [15] | Download Scientific Diagram](https://www.researchgate.net/publication/342127777/figure/fig1/AS:1067600981291008@1631547317634/Sequences-of-T7-and-SP6-promotor-on-pGEM-T-Easy-vector-15.jpg "Sequences of T7 and SP6 promotor on pGEM-T Easy vector [15] | Download Scientific Diagram")
Sequences of T7 and SP6 promotor on pGEM-T Easy vector [15] | Download Scientific Diagram
Vector-and insert-specific primers used for sequencing the Homarus... | Download Table
Table SI. Primers used in the NRAS sequencing. Primer name Primer sequence NRAS exon2 forward primer CAACAGGTTCTTGCTGGTGT NRAS e
Addgene: SP6-hCas9-Ce-mRNA
Maximizing transcription of nucleic acids with efficient T7 promoters | Communications Biology
Construction of full-length monomeric cDNA clones of CSVd-SK1. (A)... | Download Scientific Diagram
The Sp6 transcript. (A) Alignment of the nucleotide sequences of the... | Download Scientific Diagram
Sequence of forward and reverse primers used in this study. | Download Table
Effects of saturation mutagenesis of the phage SP6 promoter on transcription activity, presented by activity logos | PNAS
SP6 RNA Polymerase Promoter Sequencing Primer
MultiFRAGing: Rapid and Simultaneous Genotyping of Multiple Alleles in a Single Reaction | Scientific Reports
HiScribe® SP6 RNA Synthesis Kit | NEB
The Length of Promoter Sequence Affects The De Novo Initiation By T7 RNA Polymerase in Vitro: New Insights Into The Evolution of Promoters For Single Subunit RNA Polymerases | bioRxiv
Effects of saturation mutagenesis of the phage SP6 promoter on transcription activity, presented by activity logos | PNAS
List of primers used for DNA sequencing | Download Scientific Diagram
Primer sequences for the Real-Time RT PCR analysis. | Download Table
Addgene: pAC-SP6
A Simple and Efficient Method for Assembling TALE Protein Based on Plasmid Library | PLOS ONE
Schematic of sgRNA synthesis and three-primer PCR strategies for... | Download Scientific Diagram
